Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Hsa_circ_0014717 | |||
Gene | CCT3 | Organism | Human |
Genome Locus | chr1:156290629-156304709:- | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | #N/A (C19) |
DBLink | Link to database | PMID | 29571246 |
Experimental Method | |||
Sample Type | Tissue and cell lines | Comparison | 46pair-matched CRC tissues and adjacent normal tissues |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TTGCCCTGGATGCTGTCAAG ReverseGGTCATCACAATGCCTCCCAT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Wang, F, Wang, J, Cao, X, Xu, L, Chen, L (2018). Hsa_circ_0014717 is downregulated in colorectal cancer and inhibits tumor growth by promoting p16 expression. Biomed. Pharmacother., 98:775-782. |